Journal: Cell reports

Article Title: Diet-induced modifications to human microbiome reshape colonic homeostasis in irritable bowel syndrome.

doi: 10.1016/j.celrep.2022.111657

Figure Lengend Snippet: Figure 1. Low-FODMAP diet modifies gut microbiome composition in patients with IBS-D (A) Experimental design: a longitudinal cohort of therapy-naive patients with IBS-D (n = 10; patients exhibited IBS symptoms for at least a year) included clinical evaluations and microbiome sampling throughout 6 weeks of low-FODMAP diet. Microbiome composition was determined by 16S rRNA gene sequencing. The functional impact of post-diet microbiota was determined by ex vivo stimulation of colon organ cultures with patient microbiota samples pre- and post-diet. Colonic gene expression was determined using bulk RNA sequencing followed by predictions of reciprocal associations between specific microbial taxa and differentially expressed host genes. (B) Weight loss was observed in patients with IBS-D following low-FODMAP diet. Weight is represented as a fraction of the initial (pre-diet) weight, at the mid- phase (3 weeks), and at the end phase (6 weeks) of the diet. Colored lines represent individual patients, and black line represents average weight change with standard error bars. Statistical significance was determined by one-way ANOVA with multiple comparisons, **adjusted p value = 0.003. (C and D) Normalized abundance of A. timonensis (C) and B. adolescentis (D) in patients’ gut microbiota at the beginning (0 weeks), middle (3 weeks), and end (6 weeks) of low-FODMAP diet. Legend: patient ID by color. Statistical significance was determined by Wald test (DESeq), **p < 0.01.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ZO-1 Polyclonal Antibody Invitrogen Cat#40–2200 Purified Mouse Anti-Human ZO-1 BD bioscience Cat#610967 Cy5-AffiniPure Donkey Anti-Mouse IgG (H + L) Jackson Cat#715-175-151 Cy3-AffiniPure Donkey Anti-Rabbit IgG (H + L) Jackson Cat#711-165-152 Bacterial and virus strains Bifidobacterium adolescentis DSMZ Cat#20083 Bacteroides fragilis ATCC Cat#NCTC 9343 Biological samples Human fecal samples of IBS-D patients This paper N/A Chemicals, peptides, and recombinant proteins SYBER green Thermo Fisher scientific Cat#4385614 TOS-propionate agar medium MERCK Cat#43314 Lithium mupirocin MERCK Cat#73346-79-9 RNAlater RNAStabilization Reagent (50mL) Qiagen Cat#76104 Fluorescein isothiocyanate–dextran MERCK Cat#FD-4 CytoView Z, 96-well impedance Axion BioSystems Cat#Z96-IMP-96B-25 Fluoroshield MERCK F6182 Critical commercial assays NextSeq 500 High Output v2 kit Illumina Cat#FC-404-2005 DNeasy PowerSoil Kit Qiagen Cat#12888–100 Miseq V2 Kit Illumina Cat#MS-103-1002 Direct-zolTM RNA Microprep Zymo Cat#R2062 qSqript Quanta bio Cat#95047–100 RNEASY Micro kit (50) Qiagen Cat#20–74004 RNeasy Plus Universal Mini QIAGEN kit Qiagen Cat#74134 TruSeq stranded mRNA library prep kit Illumina Cat#20020594 Deposited data Raw and normalized data (16S and RNAseq) This paper GEO: GSE215050 Experimental models: Cell lines CaCo-2 human colon colorectal adenocarcinoma cell line Kindly provided by Prof. Ohad Gal-Mor, Sheba Medical Center, Israel Experimental models: Organisms/strains C57BL/6JOlaHsd mice Envigo, Israel Cat#2BL-623 Oligonucleotides Forward primer for Eef2 RT-PCR: AACTTCACGGTAGACCAGATCC N/A Reverse primer for Eef2 RT-PCR: TCGTCCTTCCGGGTATCAGTG N/A Forward primer for Tjp1 RT-PCR: CGGTCCTCTGAGCCTGTAAG N/A Reverse primer for Tjp1 RT-PCR: GGATCTACATGCGACGACAA N/A (Continued on next page) Cell Reports 41, 111657, November 15, 2022 e1

Techniques: Sampling, Sequencing, Functional Assay, Ex Vivo, Gene Expression, RNA Sequencing

Journal: Cell reports

Article Title: Diet-induced modifications to human microbiome reshape colonic homeostasis in irritable bowel syndrome.

doi: 10.1016/j.celrep.2022.111657

Figure Lengend Snippet: Figure 3. B. adolescentis disrupts TJ integrity and epithelial barrier functions (A) Gene expression assessed by RT-PCR in CaCo-2 cells co-cultured for 4 h with B.adolescentis or B.fragilis. Computed tomography (CT) values are normalized to the reference gene, Eef2. Data acquired by three independent experiments. (B and C) Confocal microscopy images stained for ZO-1 (B) and quantification of mean fluorescence intensity (MFI) (C) of CaCo-2 cells following different treatments.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ZO-1 Polyclonal Antibody Invitrogen Cat#40–2200 Purified Mouse Anti-Human ZO-1 BD bioscience Cat#610967 Cy5-AffiniPure Donkey Anti-Mouse IgG (H + L) Jackson Cat#715-175-151 Cy3-AffiniPure Donkey Anti-Rabbit IgG (H + L) Jackson Cat#711-165-152 Bacterial and virus strains Bifidobacterium adolescentis DSMZ Cat#20083 Bacteroides fragilis ATCC Cat#NCTC 9343 Biological samples Human fecal samples of IBS-D patients This paper N/A Chemicals, peptides, and recombinant proteins SYBER green Thermo Fisher scientific Cat#4385614 TOS-propionate agar medium MERCK Cat#43314 Lithium mupirocin MERCK Cat#73346-79-9 RNAlater RNAStabilization Reagent (50mL) Qiagen Cat#76104 Fluorescein isothiocyanate–dextran MERCK Cat#FD-4 CytoView Z, 96-well impedance Axion BioSystems Cat#Z96-IMP-96B-25 Fluoroshield MERCK F6182 Critical commercial assays NextSeq 500 High Output v2 kit Illumina Cat#FC-404-2005 DNeasy PowerSoil Kit Qiagen Cat#12888–100 Miseq V2 Kit Illumina Cat#MS-103-1002 Direct-zolTM RNA Microprep Zymo Cat#R2062 qSqript Quanta bio Cat#95047–100 RNEASY Micro kit (50) Qiagen Cat#20–74004 RNeasy Plus Universal Mini QIAGEN kit Qiagen Cat#74134 TruSeq stranded mRNA library prep kit Illumina Cat#20020594 Deposited data Raw and normalized data (16S and RNAseq) This paper GEO: GSE215050 Experimental models: Cell lines CaCo-2 human colon colorectal adenocarcinoma cell line Kindly provided by Prof. Ohad Gal-Mor, Sheba Medical Center, Israel Experimental models: Organisms/strains C57BL/6JOlaHsd mice Envigo, Israel Cat#2BL-623 Oligonucleotides Forward primer for Eef2 RT-PCR: AACTTCACGGTAGACCAGATCC N/A Reverse primer for Eef2 RT-PCR: TCGTCCTTCCGGGTATCAGTG N/A Forward primer for Tjp1 RT-PCR: CGGTCCTCTGAGCCTGTAAG N/A Reverse primer for Tjp1 RT-PCR: GGATCTACATGCGACGACAA N/A (Continued on next page) Cell Reports 41, 111657, November 15, 2022 e1

Techniques: Gene Expression, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Computed Tomography, Confocal Microscopy, Staining

Journal: Current biology : CB

Article Title: A conserved PDZ Binding Motif in aPKC interacts with Par-3 and mediates cortical polarity

doi: 10.1016/j.cub.2019.12.055

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Doe Lab N/A D. melanogaster: elav-Gal4, UAS-mCD8:GFP, hs:flp; FRT-G13, tubPGal80 Bloomington Drosophila Stock Center RRID:BDSC_5145 Oligonucleotides Recombinant DNA pCMV mammalian expression plasmid ThermoFisher 10586014 pMal C4X bacterial expression plasmid Addgene 75288 pGex 4Ti bacterial expression plasmid Amersham 27458001 pUASTattB fly cloning and transformation plasmid Addgene EF362409.1 Software and Algorithms ImageJ GraphPad Other PD10 Desalting columns 95017–001 VivaSpin 20 sample concentrators MWCO 30kD VWR 95056–130 VivaSpin 20 sample concentrators MWCO 10kD VWR 95056–128 Shaker Flasks – 125mL VWR 89095–258 Open in a separate window KEY RESOURCES TABLE Par-3 and Par-6/aPKC interact through a PDZ2 – PDZ Binding Motif interaction The Par-3 PDZ2 interaction with the aPKC PBM is conserved across metazoan The aPKC PBM is required for cortical polarity in Drosophila neuroblasts

Techniques: Diagnostic Assay, Recombinant, Construct, Variant Assay, Expressing, Blocking Assay, Plasmid Preparation, Clone Assay, Transformation Assay, Software

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: Filtrate volumes of samples and wash solution at different cell densities for metabolite sampling using automated fast filtration directly from bioreactor cultures. (A) C. glutamicum wild type. (B) C. glutamicum LP917. Mean values and standard deviations were calculated from three technical replicates.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: Sampling, Filtration

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: Cultivation profiles of C. glutamicum wild type and LP917 during batch cultures. (A) Biomass growth as optical density OD660. Means and standard deviations of optical density were calculated from three technical replicates. (B) Extracellular Lysine concentration. Mean values were calculated from two analytical replicates and the whiskers show the upper and lower value, respectively.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: Concentration Assay

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: Time points for intracellular metabolite sampling using automated fast filtration

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: Sampling, Filtration

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: Concentration profiles of intracellular metabolites during batch cultures of C. glutamicum wild type and C. glutamicum LP917. The sampling points are displayed by the biomass concentrations according to Table ​Table1.1. Mean values and standard deviations were calculated from three technical replicate samples.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: Concentration Assay, Sampling

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: Concentration profiles of intracellular metabolites during batch cultures of C. glutamicum wild type and C. glutamicum LP917. The sampling points are displayed by the biomass concentrations according to Table ​Table1.1. Mean values and standard deviations were calculated from three technical replicate samples.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: Concentration Assay, Sampling

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: Comparison of intracellular amino acid levels of C. glutamicum wild type and LP917. The relative difference δ describes the normalized overall difference for all sampling points during the exponential growth phase: positive values represent higher intracellular levels in the lysine‐producing strain LP917 compared to the wild type. Error bars represent the normalized cumulated errors of the five sampling points during exponential growth.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: Sampling

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: In vitro inhibition profiles of aspartate kinase for lysine, threonine and concerted inhibition of both amino acids according to 17. The shaded areas represent the in vivo concentration ranges of intracellular lysine   and threonine   determined in this study (25% to 75% quartile of the concentrations determined during exponential growth). (A) C. glutamicum wild type. (B) C. glutamicum LP917.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: In Vitro, Inhibition, In Vivo, Concentration Assay

Journal: Engineering in Life Sciences

Article Title: Analysis of intracellular metabolites of Corynebacterium glutamicum at high cell density with automated sampling and filtration and assessment of engineered enzymes for effective l ‐lysine production

doi: 10.1002/elsc.201600163

Figure Lengend Snippet: In vitro inhibition profiles of phosphoenolpyruvate carboxylase for Aspartate and malate, according to 19. The shaded areas represent the in vivo concentration ranges of intracellular Aspartate   and malate   determined in this study (25% to 75% quartile of the concentrations determined during exponential growth). (A) C. glutamicum wild type. (B) C. glutamicum LP917.

Article Snippet: The bacterial strains cultivated in this study were the wild‐type strain C. glutamicum ATCC 13032 and the l ‐lysine‐producing mutant strain C. glutamicum LP917, which has the point mutation Q298G in the lysC gene and N917G in the PEPC gene as described previously 17 , 19 .

Techniques: In Vitro, Inhibition, In Vivo, Concentration Assay

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: The Viable But Non-Culturable State of Listeria monocytogenes in the One-Health Continuum

doi: 10.3389/fcimb.2022.849915

Figure Lengend Snippet: VBNC Lm induced by antimicrobials and/or in biofilms.

Article Snippet: Cocktail of three strains (ATCC 7644, ATCC 19112, ATCC 19117) , Essential oils in meat-based broth and PBS at 30°C, 7 log CFU/mL , 60 to 180 minutes , .

Techniques: Incubation, Concentration Assay, Environmental Sampling, Control, Bacteria

Journal: PLoS ONE

Article Title: Similar Gene Estimates from Circular and Linear Standards in Quantitative PCR Analyses Using the Prokaryotic 16S rRNA Gene as a Model

doi: 10.1371/journal.pone.0051931

Figure Lengend Snippet: Expected bacterial 16S rRNA gene copies were calculated based on four and five 16S copies per genome for ( a ) P. aeruginosa and ( b ) D. vulgaris , respectively. Black bars = predicted 16S copies. White bars = estimated 16S copies based on supercoiled plasmid standard. Grey bars = estimated 16S copies based on nicked-circular plasmid standard. Black and white striped bars = estimated 16S copies based on linearized plasmid standard. Black and gray striped bars = estimated 16S copies based on amplicon-based standard. Data are the average (n = 3) and error bars are ±1 standard deviation among replicates.

Article Snippet: Lyophilized genomic DNA samples from Desulfovibrio vulgaris subsp. vulgaris strain Hildenborough (NCIB 8303/ATCC 29579), Pseudomonas aeruginosa strain PAO1-LAC (ATCC 47085), Archaeoglobus fulgidus strain VC16 (DSM 4304/ATCC 49203), and Methanocaldococcus jannaschii strain JAL-1 (DSM 2661/ATCC 43067) were purchased from the American Type Culture Collection (ATCC).

Techniques: Plasmid Preparation, Amplification, Standard Deviation

Journal: PLoS ONE

Article Title: Similar Gene Estimates from Circular and Linear Standards in Quantitative PCR Analyses Using the Prokaryotic 16S rRNA Gene as a Model

doi: 10.1371/journal.pone.0051931

Figure Lengend Snippet: Estimated and expected 16S rRNA gene copies in microbial gDNA samples based on qPCR standard curves.

Article Snippet: Lyophilized genomic DNA samples from Desulfovibrio vulgaris subsp. vulgaris strain Hildenborough (NCIB 8303/ATCC 29579), Pseudomonas aeruginosa strain PAO1-LAC (ATCC 47085), Archaeoglobus fulgidus strain VC16 (DSM 4304/ATCC 49203), and Methanocaldococcus jannaschii strain JAL-1 (DSM 2661/ATCC 43067) were purchased from the American Type Culture Collection (ATCC).

Techniques: Amplification